Protocols used for MLST of Yersinia pseudotuberculosis

Genes

The Y. pseudotuberculosis MLST scheme uses internal fragments of the following seven house-keeping genes:

  • adk (adenylate kinase)
  • argA (N-acetylglutamate synthase)
  • aroA (3-phosphoshikimate-1-carboxylvinyltransferase)
  • glnA (glutamine synthase)
  • thrA (aspartokinase I/homoserine dehydrogenase I)
  • tmk (thymidylate kinase)
  • trpE (anthranilate synthase component I)

PCR Amplification

The primer pairs we use for the PCR amplification of internal fragments of these genes are:

| | Product length:|

|-|-|-| |*adk_P1*:| F 5’-ATGCGTATCATTCTGCTGGG-3’|641 bp | |*adk_P2*:| R 5’-CCGAGAATAGTCGCCAGTTC-3’| | |||| |*argA_P1*:| F 5’-GGATTTCGCCACTCAGTTCC-3’ |615 bp | |*argA_P2*:| R 5’-ATCAGTCACCCCTTGTGATG-3’| | |||| |*aroA_P3*:| F 5’-AGCGGCCAATTGGCCATTTG-3’|802 bp| |*aroA_P4*:| R 5’-CACATCGCCATACGGTGGTC-3’|| |||| |*glnA_P1*:| F 5’-GCTGACTTCTTCGAAGAAGG-3’|701 bp| |*glnA_P2*:| R 5’-GACATATGGCAGTGCATACC-3’|| |||| |*thrA_P3*:| F 5’-CGTCTTTGCGGTGATGTCG-3’|823 bp| |*thrA_P2*:| R 5’-GTTGGTGTCATACAAGAATTTACG-3’|| |||| |*tmk_P3*:| F 5’-TATTGAAGGGCTTGAAGGGG-3’|606 bp| |*tmk_P4*:| R 5’-TGATTGGTCAGCCACTGAGC-3’|| |||| |*trpE_P3*:| F 5’-CACCAGTTACAACAAGCGCC-3’|743 bp| |*trpE_P4*:| R 5’-GTATCCAAATCACCGTGAGC-3’||

An annealing temperature of 55° C is fine for all genes.

Sequencing

adk_S1: F 5’-TGGAGAAATACGGCATTCCG-3’ adk_S2: R 5’-ACATTACGGGTTCCGTCCAG-3’

argA_S3: F 5’-CAAGACATTTGTTGTCATGC-3’ argA_S4: R 5’-ATGGCTAACTGAGTTGCAAC-3’

aroA_S3: F 5’-TGCACAGATCGATTATCTGG-3’ aroA_S2: R 5’-ATGGTCATTGCAGCATCAGG-3’

glnA_S1: F 5’-TTTGATGGCTCCTCGATTGGTG-3’ glnA_S2: R 5’-TTGGTCATGGTATTGAAGCG-3’

thrA_S1: F 5’-GATGTGATGGAACATCTGGC-3’ thrA_S2: R 5’-GTCACCACATGGAAGCCATC-3’

tmk_S5: F 5’-GGCCCAAGGGATTAACGATAT-3’ tmk_S2: R 5’-AATGGGTTGGGAGGCATCAAT-3’

trpE_S1: F 5’-CCAGAGATGGCGTTACAGTG-3’ trpE_S4: R 5’-TAGCCCACTGCACCGCCGTA-3’

Allele template

Allelic profile of Y. pseudotuberculosis strain SP93422.

*adk* (389 bp):
AAAGCAGGTTCTGAGTTAGGTCTGAAAGCAAAAGAAATTATGGATGCGGGCAAGTTGGTGACTGATGAGTTAGTTATCGCAT
TAGTCAAAGAACGTATCACACAGGAAGATTGCCGCGATGGTTTTCTGTTAGACGGGTTCCCGCGTACCATTCCTCAGGCAGAT
GCCATGAAAGAAGCCGGTATCAAAGTTGATTATGTGCTGGAGTTTGATGTTCCAGACGAGCTGATTGTTGAGCGCATTGTCGG
CCGTCGGGTACATGCTGCTTCAGGCCGTGTTTATCACGTTAAATTCAACCCACCTAAAGTTGAAGATAAAGATGATGTTACCG
GTGAAGAGCTGACTATTCGTAAAGATGATCAGGAAGCGACTGTCCGTAAGCGTCTTAT

*argA* (361 bp):
CTAGTATCGTCAACGATATAGGCTTATTACATAGCCTTGGGATCAGATTAGTCGTGGTATACGGTGCCCGACCACAGATTGAC
AGTAATCTGGCAGATCATAACTACGAACCTATTTATCATAAACATACCCGAGTGACTGACGCCCGGACTCTGGAGATGGTCA
AGCAAGCGGCCGGTTTATTACAACTGGATATCACGGCCAGGCTTTCAATGAGTTTGAACAACACCCCACTGCAAGGTGCTCAT
ATCAACGTAGTTAGCGGTAACTTTATCATTGCTCAACCGCTAGGTGTGGATGATGGTGTTGATTATTGCCATAGCGGGCGTATC
CGGCGCATTGATGAAGAAGCTATTCATCG

*aroA* (357 bp):
TTGATGGGCGTGTCTCTAGCCAGTTCCTGACTGCTTTATTGATGACCGCCCCGCTGGCGGAGCAAGATACGACTATTCGGATT
TGGGTGATCTGGTTTCCAAACCTTATATCGATATTACTCTGCACTTGATGAAAGCATTTGGTATTGACGTGGGGCATGAGAAC
TACCAAATTTTCCACATCAAAGGGGGTCAGACCTACCGCTCACCAGGGACTTATTTGGTTGAGGGCGATGCCTCGTCGGCTTC
CTACTTCTTAGCGGCTGCGGCTATTAAGGGGGGAACAGTGCGTGTCACTGGTATTGGCAAGAAAAGTGTACAGGGCGACACT
AAATTTGCCGATGTGTTGGAAAAAA

*glnA* (338 bp):
CACTGATTATCCGTTGTGACATTCTTGAGCCAGGCACCATGCAGGGCTATGACCGCGATCCACGTTCTATCTCCAAACGTG
TGAAGACTTCCTGAAATCTTCAGGTATCGCTGATACCGTGTTGTTCGGGCCAGAACCAGAATTCTTCCTGTTTGACGATATC
CGTTTTGGTAGCAGCATCAATGGGTCACACGTATCCATCGATGACGTCGAAGGCGCATGGAACTCCAGCACCAAATACGA
AGGCGGCAACAAAGGCCACCGTCCTGCAGTAAAAGGCGGTTACTTCCCTGTTCCTCCGGTCGACTCTGCACAAGACCTCC
GTTCTGCCATGTGT

*thrA* (342 bp):
TCAATATTATTGCTATCGCTCAAGGCTCGTCTGAGCGCTCTATTTCTGTGGTTGTCAATAATGATGCGGTCACTACCGGGGTGC
AGTTTGCCACCAGATGCTGTTTAACACGGATCAAGTCATTGAGGTGTTTGTCATTGGCGTGGGTGGTGTGGGGGGCGCATTAA
TCGAACAAATCTATCGCCAGCAACCGTGGTTGAAACAGCGTCATATCGATTTACGTGTTTGTGGTATCGCGAATTCCAAAGCC
ATGTTGACCAACGTGCATGGCATTGCATTAGATAACTGGCGTCAGGAACTGGCTGAAGTTCAGGAGCCGTTTAACCTGAGCC
GCTTGATCC

*tmk* (375 bp):
AAAACTGCGTGATTTGATTAAGCAAGGTATTGACGGTGAGGTCCTGACGGATAAAGCCGAGGTATTAATGCTGTATGCCG
CCAGGGTGCAATTAGTAGAAAATGTCATCAAGCCAGCACTGGCGCGTGGCAGTTGGGTTGTGGGTGACCGCCATGATTTG
TCATCACAGGCATATCAGGGCGGGGGGCGAGGGATTGACAGCCAACTGATGGCCTCGTTACGTGACACGGTGTTAGGCG
AATTCCGGCCAGACCTGACCTTATATTTGGATCTGCCACCGGCTGTGGGCTTGGCGCGCGCGCGCGCGCGCGGTGAATTGG
ACCGTATCGAACAAGAGTCACTGGCGTTTTTTGAGCGAACCCGCGCACGTTACCT

*trpE* (465 bp):
CCATCCCGCCGTTTTACGCTGCCCTGCCCATCACCGCTGGCGGCCTATCAGACACTGAAAGACCATAATCCCAGCCCCTAC
ATGTTTTTCATGCAAGACAATGATTTTTCTCTGTTTGGCGCATCACCTGAAAGCGCACTGAAATACGATGCCAGCAACCGT
CAAATTGAGATTTACCCGATTGCGGGTACTCGTCCACGCGGTCGTCGTCCTAATGGAGAACTCGATCGTGATTTAGACAG
CCGTATCGAGTTGGAAATGCGTACTGACCATAAAGAGATGGCAGAACATTTAATGTTGGTGGATCTGGCTCGTAACGATC
TGGCACGTATTTGCGAACCCGGTAGCCGCTATGTTGCAGATTTAACCAAAGTTGACCGTTACTCTTTTGTCATGCATCTGG
TGTCCCGCGTGATTGGCACTCTGCGTCAAGATTTAGATGTGCTGCATGCTTATCAAGCGTGT